thap3

Ensembl ID:
ENSDARG00000041080
ZFIN ID:
ZDB-GENE-050327-4
Description:
THAP domain containing, apoptosis associated protein 3 [Source:RefSeq peptide;Acc:NP_001014316]
Human Orthologue:
THAP3
Human Description:
THAP domain containing, apoptosis associated protein 3 [Source:HGNC Symbol;Acc:20855]
Mouse Orthologue:
Thap3
Mouse Description:
THAP domain containing, apoptosis associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:1917126]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37747 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060193 Nonsense 36 213 2 4
Genomic Location (Zv9):
Chromosome 23 (position 30965738)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 30800628
GRCz11 23 30727159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTCCATTCTTTGTCAGGTTCCCTTTCAGTAAACCATCGGTTCTGAAA[C/T]AATGGCTTGATAACATTGGACGAGACGACTTTCAGCCAAGGAAACACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link