Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
mier1a
- Ensembl ID:
- ENSDARG00000041072
- ZFIN ID:
- ZDB-GENE-030131-409
- Description:
- mesoderm induction early response 1 homolog a [Source:RefSeq peptide;Acc:NP_955853]
- Human Orthologue:
- MIER1
- Human Description:
- mesoderm induction early response 1 homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:29657]
- Mouse Orthologue:
- Mier1
- Mouse Description:
- mesoderm induction early response 1 homolog (Xenopus laevis Gene [Source:MGI Symbol;Acc:MGI:1918398]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa31523 | Splice Site, Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31523
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000060169 | Splice Site, Nonsense | 242 | 469 | 8 | 13 |
The following transcripts of ENSDARG00000041072 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 6 (position 34992666)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 34848862 GRCz11 6 34832245 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCTGGTGTCGACGCCATTCCTGAAGGATCTCACATCAAAGACAATGAA[C/T]AGGCAGGTCTCCATCCCATGGGATATTTACCTTAATCATACTGATTCCCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
