zgc:92326

Ensembl ID:
ENSDARG00000041060
ZFIN ID:
ZDB-GENE-040718-159
Description:
galactoside-binding soluble lectin 9 [Source:RefSeq peptide;Acc:NP_001001817]
Human Orthologues:
LGALS7, LGALS7B
Human Descriptions:
lectin, galactoside-binding, soluble, 7 [Source:HGNC Symbol;Acc:6568]
lectin, galactoside-binding, soluble, 7B [Source:HGNC Symbol;Acc:34447]
Mouse Orthologue:
Lgals7
Mouse Description:
lectin, galactose binding, soluble 7 Gene [Source:MGI Symbol;Acc:MGI:1316742]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13061 Essential Splice Site Available for shipment Available now
sa42575 Nonsense Mutation detected in F1 DNA During 2018
sa42574 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42573 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa13061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033380 Essential Splice Site 42 310 2 10
ENSDART00000060157 Essential Splice Site 42 320 2 11

The following transcripts of ENSDARG00000041060 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30362879)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31184586
GRCz11 15 31065327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACRGGAAAAGCATTATCATAAGTGGACGGGTTTTACCAGGTGCTAACAGG[T/C]GAGGAATAATATAAAAGTTTTCAAAAACAAAAGTTTTTAGGTGGATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033380 Nonsense 109 310 3 10
ENSDART00000060157 Nonsense 109 320 3 11

The following transcripts of ENSDARG00000041060 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30360379)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31182086
GRCz11 15 31062827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAAAGGTCAAACATTCACCCTGCAGATCCTCGTTGCCCAAGACAGATA[C/A]AAGGTACAGGAATGTTCACCTTGTTCAAGTGTTTTTGAGCAGCATTAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42574
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033380 Essential Splice Site 210 310 8 10
ENSDART00000060157 Essential Splice Site 220 320 9 11

The following transcripts of ENSDARG00000041060 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30357165)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31178872
GRCz11 15 31059613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGCAAAAACATTGTCATCAATGGAATTGTCAACCCTAATGCTAAAAGG[T/C]TAGACATTTAATTGCCATAGTGTTGTTTGAATTTCAACTAACATTTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033380 Nonsense 272 310 10 10
ENSDART00000060157 Nonsense 282 320 11 11

The following transcripts of ENSDARG00000041060 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 30353074)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 31174781
GRCz11 15 31055522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTTGTATTTGTGTTGCAGGTCACCATCTCCTGTAATCCCCAACACTA[C/A]AATGTCTTTGTCAATGGCAAACAAGTACACACTTACAAACATCGCTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link