st3gal4

Ensembl ID:
ENSDARG00000041006
ZFIN ID:
ZDB-GENE-050309-174
Description:
CMP-N-acetylneuraminate-beta-galactosamide-alpha-2, 3-sialyltransferase 4 isoform 1 [Source:RefSeq
Human Orthologue:
ST3GAL4
Human Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 4 [Source:HGNC Symbol;Acc:10864]
Mouse Orthologue:
St3gal4
Mouse Description:
ST3 beta-galactoside alpha-2,3-sialyltransferase 4 Gene [Source:MGI Symbol;Acc:MGI:1316743]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12760 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12760
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097259 Nonsense 238 335 8 10
Genomic Location (Zv9):
Chromosome 18 (position 47449862)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48712687
GRCz11 18 48707474
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCTTGGCCGGGCTARTCAGATCCGTGTGCTGGACCCGTATTTCCTC[C/T]GAATAACAGCRCGAAAGTTTCTCCAAATTCCCGTGCAGCCGCGCAAACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link