usp37

Ensembl ID:
ENSDARG00000040990
ZFIN ID:
ZDB-GENE-061013-802
Description:
ubiquitin carboxyl-terminal hydrolase 37 [Source:RefSeq peptide;Acc:NP_001070811]
Human Orthologues:
USP26, USP29, USP37
Human Descriptions:
ubiquitin specific peptidase 26 [Source:HGNC Symbol;Acc:13485]
ubiquitin specific peptidase 29 [Source:HGNC Symbol;Acc:18563]
ubiquitin specific peptidase 37 [Source:HGNC Symbol;Acc:20063]
Mouse Orthologues:
Usp26, Usp29, Usp37
Mouse Descriptions:
ubiquitin specific peptidase 26 Gene [Source:MGI Symbol;Acc:MGI:1933247]
ubiquitin specific peptidase 29 Gene [Source:MGI Symbol;Acc:MGI:1888998]
ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44698 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000082300 Nonsense 401 935 11 24
ENSDART00000129632 Nonsense 401 937 11 24
ENSDART00000130720 Nonsense 401 938 11 25

The following transcripts of ENSDARG00000040990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 715217)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 729945
GRCz11 9 729578
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGATCTTCTGCGGCGAGTGAAGAACGCCATTTCTTCAACAGCGGAG[C/T]GATTCTCTGGATACATGCAGAACGTAAGTATTTATTTCATACCTGTGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link