tpi1b

Ensembl ID:
ENSDARG00000040988
ZFIN ID:
ZDB-GENE-020416-4
Description:
Triosephosphate isomerase B [Source:UniProtKB/Swiss-Prot;Acc:Q90XG0]
Human Orthologue:
TPI1
Human Description:
triosephosphate isomerase 1 [Source:HGNC Symbol;Acc:12009]
Mouse Orthologue:
Tpi1
Mouse Description:
triosephosphate isomerase 1 Gene [Source:MGI Symbol;Acc:MGI:98797]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36059 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36059
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060056 Essential Splice Site 107 248 None 7
ENSDART00000132468 Essential Splice Site 114 198 None 8

The following transcripts of ENSDARG00000040988 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 13993643)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12352734
GRCz11 16 12243636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTCTGGGACACTCAGAGAGACGCCACGTGTTTGGAGAGAGTGATGAGG[T/C]AATTTACACACTATTTATTACAAACTAAATCTAAAGCTGTTGTAATGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link