
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
itgbl1
- Ensembl ID:
- ENSDARG00000040985
- ZFIN ID:
- ZDB-GENE-050522-410
- Description:
- integrin beta-like protein 1 [Source:RefSeq peptide;Acc:NP_001019243]
- Human Orthologue:
- ITGBL1
- Human Description:
- integrin, beta-like 1 (with EGF-like repeat domains) [Source:HGNC Symbol;Acc:6164]
- Mouse Orthologue:
- Itgbl1
- Mouse Description:
- integrin, beta-like 1 Gene [Source:MGI Symbol;Acc:MGI:2443439]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa41453 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa41454 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa41453
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060054 | Essential Splice Site | 31 | 406 | 1 | 8 |
ENSDART00000139584 | None | 186 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 32786160)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 31942106 GRCz11 9 31752852 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTCATCTTGCTCTCTGCCATTCGAGGAAGTTTACAGCAGTCGCTAAGG[T/G]GAGTTTAAGCTGTGTTGTTTTCTTAAACCAATTTGGCTTTTCCACTCTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41454
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060054 | Essential Splice Site | 148 | 406 | 3 | 8 |
ENSDART00000139584 | None | 186 | None | 5 |
- Genomic Location (Zv9):
- Chromosome 9 (position 32815753)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 9 31971699 GRCz11 9 31782445 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCAAAGACCTCTGCCGCAATGCTCAGGGTGTAGTTTGCTCCAATGCAGG[T/C]AAGATACACATCACCCAGAGACTTATAGTGTTGAGAAAGGCATACAGTAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Waist-to-hip circumference ratio (interaction): Gene-environment interactions and obesity traits among postmenopausal African-American and Hispanic women in the Women's Health Initiative SHARe Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: