zgc:113149

Ensembl ID:
ENSDARG00000040966
ZFIN ID:
ZDB-GENE-050320-56
Description:
hypothetical protein LOC541363 [Source:RefSeq peptide;Acc:NP_001013508]
Human Orthologue:
NAIF1
Human Description:
nuclear apoptosis inducing factor 1 [Source:HGNC Symbol;Acc:25446]
Mouse Orthologue:
Naif1
Mouse Description:
nuclear apoptosis inducing factor 1 Gene [Source:MGI Symbol;Acc:MGI:1918504]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35907 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060034 Nonsense 2 382 2 5

The following transcripts of ENSDARG00000040966 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28491701)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29209731
GRCz11 15 29142607
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTGCGATTGGTAACACAGCGAGGGGTTTTTGGAAGGAGGAAGGATGT[C/A]GGAGTTTATGCCGTACCCGTACAGAAGGCCGGGAGGGTCTTTGATGCGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link