zgc:101731

Ensembl ID:
ENSDARG00000040965
ZFIN ID:
ZDB-GENE-040912-57
Description:
synaptosomal-associated protein 25 [Source:RefSeq peptide;Acc:NP_001020729]
Human Orthologue:
SNAP25
Human Description:
synaptosomal-associated protein, 25kDa [Source:HGNC Symbol;Acc:11132]
Mouse Orthologue:
Snap25
Mouse Description:
synaptosomal-associated protein 25 Gene [Source:MGI Symbol;Acc:MGI:98331]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39054 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42567 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39054
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060030 Essential Splice Site 55 209 None 8
ENSDART00000133988 Essential Splice Site 55 209 None 8

The following transcripts of ENSDARG00000040965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28479853)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29197883
GRCz11 15 29130759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCCCCTTTCGATTTCCCTGCTGCCTTCCCCCATCTCCCCCGCATGGGC[A/T]GAACAACTGGACCGCATAGAAGAGGGCTTGGATCAGATCAACAAGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42567
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060030 Nonsense 137 209 6 8
ENSDART00000133988 Nonsense 137 209 6 8

The following transcripts of ENSDARG00000040965 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 28485218)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29203248
GRCz11 15 29136124
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCTCGCGTGGTGGATGAGCGAGAGAAGATGACCATGAGCGGTGGATA[T/A]ATAAGAAGGTGCCTGGACCTTTGCGCTCTTCAGCAATGTTGAATATAGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link