
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:101731
- Ensembl ID:
- ENSDARG00000040965
- ZFIN ID:
- ZDB-GENE-040912-57
- Description:
- synaptosomal-associated protein 25 [Source:RefSeq peptide;Acc:NP_001020729]
- Human Orthologue:
- SNAP25
- Human Description:
- synaptosomal-associated protein, 25kDa [Source:HGNC Symbol;Acc:11132]
- Mouse Orthologue:
- Snap25
- Mouse Description:
- synaptosomal-associated protein 25 Gene [Source:MGI Symbol;Acc:MGI:98331]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39054 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa42567 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39054
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060030 | Essential Splice Site | 55 | 209 | None | 8 |
ENSDART00000133988 | Essential Splice Site | 55 | 209 | None | 8 |
The following transcripts of ENSDARG00000040965 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 28479853)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29197883 GRCz11 15 29130759 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCCCCTTTCGATTTCCCTGCTGCCTTCCCCCATCTCCCCCGCATGGGC[A/T]GAACAACTGGACCGCATAGAAGAGGGCTTGGATCAGATCAACAAGGACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42567
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000060030 | Nonsense | 137 | 209 | 6 | 8 |
ENSDART00000133988 | Nonsense | 137 | 209 | 6 | 8 |
The following transcripts of ENSDARG00000040965 do not overlap with this mutation:
- Genomic Location (Zv9):
- Chromosome 15 (position 28485218)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 15 29203248 GRCz11 15 29136124 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCTTCTCGCGTGGTGGATGAGCGAGAGAAGATGACCATGAGCGGTGGATA[T/A]ATAAGAAGGTGCCTGGACCTTTGCGCTCTTCAGCAATGTTGAATATAGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: