si:dkey-49n23.1

Ensembl ID:
ENSDARG00000040920
ZFIN ID:
ZDB-GENE-050208-762
Description:
Novel protein similar to semaphorin 3 family (Sema3) [Source:UniProtKB/TrEMBL;Acc:Q1MTG9]
Human Orthologue:
SEMA3D
Human Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D [Source:HGNC
Mouse Orthologue:
Sema3d
Mouse Description:
sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D Gene [Source:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24202 Nonsense Available for shipment Available now
sa37551 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059965 Nonsense 582 1008 16 21
ENSDART00000133335 Nonsense 527 703 15 16
Genomic Location (Zv9):
Chromosome 22 (position 33507054)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30868592
GRCz11 22 30817787
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATAGTAAGTTAAAAGTGTTCATTGCTGTCTGTAGGCTCAGAGAATGCT[G/T]AACTGAAGACGGTTTACGGCGTGGAGACAAACTCAACTTTCCTGGAATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059965 Nonsense 940 1008 19 21
ENSDART00000133335   None 703 None 16
Genomic Location (Zv9):
Chromosome 22 (position 33447740)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 30808871
GRCz11 22 30758066
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACGCCTACAGCTGCGTGATTAACAACACCATCAGCAACAAGACTAAA[C/T]AGTTTAACACTGATGAACACTGTCCGATATGTAAAGGTATGTGAGGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link