
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bmper
- Ensembl ID:
- ENSDARG00000040893
- ZFIN IDs:
- ZDB-GENE-030219-146, ZDB-GENE-030219-146
- Description:
- BMP-binding endothelial regulator protein [Source:RefSeq peptide;Acc:NP_001018323]
- Human Orthologue:
- BMPER
- Human Description:
- BMP binding endothelial regulator [Source:HGNC Symbol;Acc:24154]
- Mouse Orthologue:
- Bmper
- Mouse Description:
- BMP-binding endothelial regulator Gene [Source:MGI Symbol;Acc:MGI:1920480]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa30999 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36040 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa108 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa30999
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059930 | Nonsense | 201 | 663 | 11 | 20 |
ENSDART00000097348 | Nonsense | 205 | 667 | 7 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 9274646)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 7230774 GRCz11 16 7171960 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTGTCCTGTTCTGTCCTGCCCGTCTCATCTTACCCACACTCCACCTGGC[C/T]AGTGCTGTCCAAGATGTCGGGGTGAGTTATTTCCTTACAGATGTTCTCAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36040
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059930 | Essential Splice Site | 340 | 663 | 14 | 20 |
ENSDART00000097348 | Essential Splice Site | 344 | 667 | 10 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 9267738)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 7237682 GRCz11 16 7178868 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGAATAAGATACTGAATCGCACTGGCTGCTGTCCTGTTTGCACTGACAG[T/C]AAGTTGACTTCTTTACACGACACTCTTATTGGAATCTTAAAAACGAACTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa108
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059930 | Nonsense | 545 | 663 | 16 | 20 |
ENSDART00000097348 | Nonsense | 549 | 667 | 12 | 16 |
- Genomic Location (Zv9):
- Chromosome 16 (position 9261799)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 7243621 GRCz11 16 7184807 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTCAAGGTGAAGCTCCGCGCTCACAGAACCTGCCAGAAGCTCAAGTCCT[G/A]GGAGTTTCAGAAGTGCCACTCTGCTGTCGACTTTACCTCCTTTTACAAGT
- Associated Phenotype:
Normal
Stage Entity Quality Tag Larval:Day 5
ZFS:0000037whole organism
ZFA:0001094quality
PATO:0000001normal
PATO:0000461
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: