si:dkey-27n14.1

Ensembl ID:
ENSDARG00000040816
ZFIN ID:
ZDB-GENE-100922-123

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16966 Nonsense Available for shipment Available now
sa6418 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16966
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059828 Nonsense 30 386 1 1
ENSDART00000135872   2 319 1 2
Genomic Location (Zv9):
Chromosome 16 (position 18820381)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16850704
GRCz11 16 16758681
KASP Assay ID:
2260-9455.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCACCTTCATACACCTTTCCTTTTTTCACTAACCTTTCCTTTCCCTCAT[C/A]ATCACCCTCTCTCTCCCCATCCCCAAGTGTAGCTTCCACTGCTCTCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059828 Nonsense 345 386 1 1
ENSDART00000135872 Nonsense 280 319 2 2
Genomic Location (Zv9):
Chromosome 16 (position 18819436)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16849759
GRCz11 16 16757736
KASP Assay ID:
554-4943.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGTGCCGGTTGGGACACAGGTGACCATWAATCGCATCCTCACAGGAT[T/A]GACTTATGGAAACTCATGTGTGAATCCGTTCTTCTACACACTCCTRACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link