tsku

Ensembl ID:
ENSDARG00000040815
ZFIN ID:
ZDB-GENE-030131-4683
Description:
Tsukushin [Source:UniProtKB/Swiss-Prot;Acc:Q58A48]
Human Orthologue:
TSKU
Human Description:
tsukushi small leucine rich proteoglycan homolog (Xenopus laevis) [Source:HGNC Symbol;Acc:28850]
Mouse Orthologue:
Tsku
Mouse Description:
tsukushin Gene [Source:MGI Symbol;Acc:MGI:2443855]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35911 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059826 Nonsense 263 366 2 2
ENSDART00000127795 Nonsense 244 347 2 2
ENSDART00000133117 Nonsense 244 347 2 2
Genomic Location (Zv9):
Chromosome 15 (position 28693804)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29411834
GRCz11 15 29344710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGACAGAATTGGTTCACCTGTCTCTCAGCGGCCTGTCCGAACTGACCT[T/A]GATTCATCCAGGTGCTTTCAGGAGTCTGAAGAACCTGCAGGCTTTAGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link