
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ncf4
- Ensembl ID:
- ENSDARG00000040812
- ZFIN ID:
- ZDB-GENE-041124-1
- Description:
- neutrophil cytosol factor 4 [Source:RefSeq peptide;Acc:NP_991274]
- Human Orthologue:
- NCF4
- Human Description:
- neutrophil cytosolic factor 4, 40kDa [Source:HGNC Symbol;Acc:7662]
- Mouse Orthologue:
- Ncf4
- Mouse Description:
- neutrophil cytosolic factor 4 Gene [Source:MGI Symbol;Acc:MGI:109186]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39377 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa32408 | Nonsense | Available for shipment | Available now |
sa43872 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39377
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032757 | Essential Splice Site | 39 | 156 | 2 | 11 |
ENSDART00000059820 | Essential Splice Site | 39 | 355 | 2 | 10 |
ENSDART00000133409 | None | 259 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 22 (position 31779224)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 29258302 GRCz11 22 29207497 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGCAACTATTGCTGATATCGAGGAGAAGAAAGGTTTCATTGTTTACTTT[G/A]TGAGTTTCCCTAGACCTGAACCCCCGGCACTTCAGCTTTCCTCCAGTCTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32408
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032757 | Nonsense | 54 | 156 | 3 | 11 |
ENSDART00000059820 | Nonsense | 54 | 355 | 3 | 10 |
ENSDART00000133409 | None | 259 | None | 8 |
- Genomic Location (Zv9):
- Chromosome 22 (position 31781531)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 29260609 GRCz11 22 29209804 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTGCAGAGTTTCGTGATTGAGGTGAAGACCAAAGGCAACAGTAAATACT[T/A]AATCTACAGAAGGTATCGAGAGTTCTTTGCTCTGCACCAGAGTTTGGAGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43872
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000032757 | None | 156 | 11 | 11 | |
ENSDART00000059820 | Nonsense | 331 | 355 | 10 | 10 |
ENSDART00000133409 | Nonsense | 237 | 259 | 8 | 8 |
- Genomic Location (Zv9):
- Chromosome 22 (position 31822603)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 29301681 GRCz11 22 29250876 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGTCGTTCTCATGGTGCAAGAGAGCAAACGCACTGAGTCAAAGGTCAAA[C/T]GACCCGTCAATCAGTTTCCCTGGGAGCTGCTGGTCACGCATGCCAAAGAT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Atopic dermatitis: Meta-analysis of genome-wide association studies identifies three new risk loci for atopic dermatitis. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: