
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
MED16
- Ensembl ID:
- ENSDARG00000040779
- Description:
- mediator complex subunit 16 [Source:HGNC Symbol;Acc:17556]
- Human Orthologue:
- MED16
- Human Description:
- mediator complex subunit 16 [Source:HGNC Symbol;Acc:17556]
- Mouse Orthologue:
- Med16
- Mouse Description:
- mediator complex subunit 16 Gene [Source:MGI Symbol;Acc:MGI:2158394]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa14925 | Essential Splice Site | Available for shipment | Available now |
sa38833 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa14925
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059752 | Essential Splice Site | 154 | 847 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 11 (position 14349383)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 14050679 GRCz11 11 14108338 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ACTTTCATGGTTACACAATGGAGTCAAACTCGCCCTGCATGTTGAAAAGG[T/C]AYAGTATGTGAATTYCCTTMCCTGCCACTGTTACTTTTGGCTTGCTTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38833
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059752 | Nonsense | 804 | 847 | 13 | 14 |
- Genomic Location (Zv9):
- Chromosome 11 (position 14384024)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 14085320 GRCz11 11 14142979 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGCGATGTTTACATCTGGGCATCTCTCCAACCGAGGATAGCAAAGCTTG[C/A]ACAAGGTATCACATTAGAATTATTCCTCTAATTAATTTAAAGTAATTCAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: