zgc:92479

Ensembl ID:
ENSDARG00000040747
ZFIN ID:
ZDB-GENE-040801-231
Description:
transmembrane 4 L6 family member 4 [Source:RefSeq peptide;Acc:NP_001003489]
Human Orthologue:
TM4SF4
Human Description:
transmembrane 4 L six family member 4 [Source:HGNC Symbol;Acc:11856]
Mouse Orthologue:
Tm4sf4
Mouse Description:
transmembrane 4 superfamily member 4 Gene [Source:MGI Symbol;Acc:MGI:2385173]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6716 Nonsense Mutation detected in F1 DNA During 2018
sa43885 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104528 Nonsense 34 198 1 5

The following transcripts of ENSDARG00000040747 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 41095857)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38184158
GRCz11 22 38137305
KASP Assay ID:
554-5383.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCCATCATCTGCGTCCTCTGCAACATCCTGCTCTTTTTCCCCAGCGGG[A/T]AAGTGGCCGATCAGAGCCAAGACATCACCGACGAAGTCTTTTACCTGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104528 Essential Splice Site 89 198 None 5

The following transcripts of ENSDARG00000040747 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 41088626)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38176927
GRCz11 22 38130074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCATTATCTTGGCTTGTTTCCACTTTAACGTTTAGTTCTTCTTTCCTGC[A/T]GATGTTCAGCTCTATTCTGTTTGCGGCGGCAGGAGCAGTGGGCGCTGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link