wdr75

Ensembl ID:
ENSDARG00000040730
ZFIN ID:
ZDB-GENE-030616-5
Description:
WD repeat-containing protein 75 [Source:UniProtKB/Swiss-Prot;Acc:Q7ZVR1]
Human Orthologue:
WDR75
Human Description:
WD repeat domain 75 [Source:HGNC Symbol;Acc:25725]
Mouse Orthologue:
Wdr75
Mouse Description:
WD repeat domain 75 Gene [Source:MGI Symbol;Acc:MGI:1920924]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14841 Nonsense Mutation detected in F1 DNA During 2018
sa21553 Essential Splice Site Available for shipment Available now
sa21552 Nonsense Available for shipment Available now
sa41503 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059667 Nonsense 103 832 4 21

The following transcripts of ENSDARG00000040730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 42221401)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41346571
GRCz11 9 41148358
KASP Assay ID:
1641-0493.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RTGTTGTTATTTTTCTTTTTTCAGACATTTGTCATTGGATACCCTTTGTA[T/A]YCATTATAMGTGTCAGAGAAACATGAAGGGGTCATTTTCCTTATTGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059667 Essential Splice Site 481 832 14 21

The following transcripts of ENSDARG00000040730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 42206241)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41331411
GRCz11 9 41133198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGAGTTCAGACACACCCGTCTCACCGCACCCCTTTTCATTTGTGTTTC[A/T]GAGGCCCAGAACTACTGGTCATGTGATTTCGTTGGCAGTTATCATAACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21552
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059667 Nonsense 629 832 17 21

The following transcripts of ENSDARG00000040730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 42198368)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41323538
GRCz11 9 41125325
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCACGGCCTTTGTTCAGCCAGAGATACGTGTGTCTAGAAAGGGTGGAT[C/T]GAGCCGTGTTTGTTCCTCGAGAAGAGCCGTTCAACAGTTGTGATGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41503
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059667 Essential Splice Site 681 832 18 21

The following transcripts of ENSDARG00000040730 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 42195842)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41321012
GRCz11 9 41122799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCAGCTCAGCAACAGAAGAGGACAGAATGTTGTCTTCTAGTAAGCGG[G/A]TATGGACTTTTGTTGTTGTTTTTAACCTTACACCTCCATTCTGCTCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link