zgc:91926

Ensembl ID:
ENSDARG00000040712
ZFIN ID:
ZDB-GENE-040801-190
Description:
[Source:RefSeq peptide;Acc:NP_001003453]
Human Orthologue:
ADPRH
Human Description:
ADP-ribosylarginine hydrolase [Source:HGNC Symbol;Acc:269]
Mouse Orthologue:
Adprh
Mouse Description:
ADP-ribosylarginine hydrolase Gene [Source:MGI Symbol;Acc:MGI:1098234]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24905 Nonsense Mutation detected in F1 DNA During 2018
sa22058 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106053 Nonsense 234 353 7 8
ENSDART00000125552 Nonsense 234 353 7 8

The following transcripts of ENSDARG00000040712 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 16067638)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15149824
GRCz11 12 15188127
KASP Assay ID:
554-7902.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGACCAGAATTTTTTTTCTCTTCATTATCTTCCTATTCTTCAAGGTA[T/A]TTGGATCTCAGAGCATTGTCTTCTGGAACTGGGCCAGTTAATTGGCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22058
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106053 Nonsense 257 353 7 8
ENSDART00000125552 Nonsense 257 353 7 8

The following transcripts of ENSDARG00000040712 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 12 (position 16067705)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 15149891
GRCz11 12 15188194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTCTGGAACTGGGCCAGTTAATTGGCCTGACAATTATGGGCCAGCT[G/T]AACGAGATGAAGCCTACAAAAGCTTTAGCCTGTCAGGTTGGGCTGGTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link