zgc:114095

Ensembl ID:
ENSDARG00000040635
ZFIN ID:
ZDB-GENE-050913-69
Description:
ring finger protein 11-like [Source:RefSeq peptide;Acc:NP_001121880]
Human Orthologue:
RNF11
Human Description:
ring finger protein 11 [Source:HGNC Symbol;Acc:10056]
Mouse Orthologue:
Rnf11
Mouse Description:
ring finger protein 11 Gene [Source:MGI Symbol;Acc:MGI:1352759]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18396 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098691 Essential Splice Site 98 154 2 3
Genomic Location (Zv9):
Chromosome 8 (position 16958447)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16403335
GRCz11 8 16439047
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGGTGTCTATGATCCAGGCAGTGACGGCACCGAGAAGAAGATCCGAGAG[T/G]GAGTCATGATRTTGTGCATCTCTGCTGCATCTTAGTCAWTCACACATGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link