v2rx1

Ensembl ID:
ENSDARG00000040632
ZFIN ID:
ZDB-GENE-050419-175
Description:
vomeronasal 2 receptor, x1 [Source:RefSeq peptide;Acc:NP_001076368]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25068 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019233 Nonsense 194 868 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31565247)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33362106
GRCz11 18 33336701
KASP Assay ID:
554-7371.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATAAGTTACTTTGCCACATGCACTTGCCTCACAGATAAAAAGGAGTA[T/A]CCTTCTTTCCTTCGCACTGTCCCTAGTGACAGGTTTCAGGTGCAGGGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link