v2rh32

Ensembl ID:
ENSDARG00000040594
ZFIN ID:
ZDB-GENE-050419-41
Description:
vomeronasal 2 receptor, h32 [Source:RefSeq peptide;Acc:NP_001076358]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5912 Nonsense Mutation detected in F1 DNA During 2018
sa43136 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa5912
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048182 Nonsense 45 855 1 6
Genomic Location (Zv9):
Chromosome 18 (position 31602604)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33399463
GRCz11 18 33374058
KASP Assay ID:
554-3776.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAAGTTGAACAGAATGTATAAGGATGGAGATTATATCATTGGAGGCT[T/A]GTTTGAGGTTCAGCACCTCAAAGTATTTCCAGAACTGAGTTTCCGAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43136
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048182 Nonsense 338 855 3 6
Genomic Location (Zv9):
Chromosome 18 (position 31603816)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 33400675
GRCz11 18 33375270
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCCATCGGGGAAAGATCAAAGGACTTCATGAATTTCTGCTACACATA[C/T]AACCTGACAATGATCCAACAAATAACATGGTGAGAATTTTTTGGGAGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link