
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
v2rh32
- Ensembl ID:
- ENSDARG00000040594
- ZFIN ID:
- ZDB-GENE-050419-41
- Description:
- vomeronasal 2 receptor, h32 [Source:RefSeq peptide;Acc:NP_001076358]
- Mouse Orthologues:
- AC139131.1, AC161211.1, AC161211.2, Vmn2r54
- Mouse Descriptions:
- vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
- vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
- vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
- vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa5912 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa43136 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa5912
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000048182 | Nonsense | 45 | 855 | 1 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 31602604)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 33399463 GRCz11 18 33374058 - KASP Assay ID:
- 554-3776.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTTCAAGTTGAACAGAATGTATAAGGATGGAGATTATATCATTGGAGGCT[T/A]GTTTGAGGTTCAGCACCTCAAAGTATTTCCAGAACTGAGTTTCCGAATGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa43136
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000048182 | Nonsense | 338 | 855 | 3 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 31603816)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 33400675 GRCz11 18 33375270 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTATCCATCGGGGAAAGATCAAAGGACTTCATGAATTTCTGCTACACATA[C/T]AACCTGACAATGATCCAACAAATAACATGGTGAGAATTTTTTGGGAGAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: