zgc:123007

Ensembl ID:
ENSDARG00000040566
ZFIN ID:
ZDB-GENE-051127-33
Description:
alanine--glyoxylate aminotransferase 2-like 2 [Source:RefSeq peptide;Acc:NP_001032646]
Human Orthologue:
AGXT2L2
Human Description:
alanine-glyoxylate aminotransferase 2-like 2 [Source:HGNC Symbol;Acc:28249]
Mouse Orthologue:
Agxt2l2
Mouse Description:
alanine-glyoxylate aminotransferase 2-like 2 Gene [Source:MGI Symbol;Acc:MGI:1920197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42542 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059369 Nonsense 178 447 6 12

The following transcripts of ENSDARG00000040566 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 22799922)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23511109
GRCz11 15 23446374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTGCATATCTACAGGCACCTCTCCCTGATACTTACCACGGTATCTA[T/A]CGAGAAGATCATCCTGAGCCTGGACAGGCTTATGCAGACACGGTCAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link