exosc5

Ensembl ID:
ENSDARG00000040557
ZFIN ID:
ZDB-GENE-060503-675
Description:
exosome complex exonuclease RRP46 isoform 2 [Source:RefSeq peptide;Acc:NP_001076540]
Human Orthologue:
EXOSC5
Human Description:
exosome component 5 [Source:HGNC Symbol;Acc:24662]
Mouse Orthologue:
Exosc5
Mouse Description:
exosome component 5 Gene [Source:MGI Symbol;Acc:MGI:107889]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45645 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45645
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059352 Essential Splice Site 36 222 None 6
ENSDART00000125931 Essential Splice Site 57 243 None 6
ENSDART00000145177 Essential Splice Site 36 128 None 3
Genomic Location (Zv9):
Chromosome 18 (position 34405803)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36084959
GRCz11 18 36065967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACAGAGTTTGTTATCAAGACCTGACGGGTCGTCCACGTTTGTACAAGG[T/A]AATTTATAAATGTTTAATGTAATTTATTTCTTTACTCATGTCATAGCAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link