
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
bckdha
- Ensembl ID:
- ENSDARG00000040555
- ZFIN ID:
- ZDB-GENE-050522-376
- Description:
- 2-oxoisovalerate dehydrogenase subunit alpha, mitochondrial [Source:RefSeq peptide;Acc:NP_001019590
- Human Orthologue:
- BCKDHA
- Human Description:
- branched chain keto acid dehydrogenase E1, alpha polypeptide [Source:HGNC Symbol;Acc:986]
- Mouse Orthologue:
- Bckdha
- Mouse Description:
- branched chain ketoacid dehydrogenase E1, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:107701]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9266 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa36694 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa17364 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9266
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059347 | Nonsense | 32 | 446 | 1 | 8 |
ENSDART00000125820 | Nonsense | 32 | 446 | 1 | 9 |
- Genomic Location (Zv9):
- Chromosome 18 (position 34406338)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 36085494 GRCz11 18 36066502 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCATGCAATTCGTCAAAACACAGCATTWAAAGCAACAACGCTTCTCCAA[C/T]AAAGGGGATTCCGCGTCAATGTAAGTCTTACGTTTATGGCAGCTGCATAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36694
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059347 | Nonsense | 358 | 446 | 8 | 8 |
ENSDART00000125820 | Nonsense | 358 | 446 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 18 (position 34420468)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 36099624 GRCz11 18 36080632 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACGACAGCTCTGCCTACCGTTCAGTGGACGAGGTGAACTACTGGGACAAG[C/T]AGGACCACCCCATCTCTCGCCTGCGCCACTACATGACAGCCCGCGATTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa17364
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000059347 | Nonsense | 444 | 446 | 8 | 8 |
ENSDART00000125820 | Nonsense | 444 | 446 | 8 | 9 |
- Genomic Location (Zv9):
- Chromosome 18 (position 34420728)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 36099884 GRCz11 18 36080892 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATGTGGAGACACGTCCAGCAATATAAAGAGCATTACCCAMTTGACCACTA[T/A]GAGAAATAATCCATGAGCCATGGACACAACTGGGAAAGKTCTTGCACATR
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: