si:dkey-22o20.1

Ensembl ID:
ENSDARG00000040547
ZFIN ID:
ZDB-GENE-050419-21
Description:
galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1 [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
B3GAT1
Human Description:
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) [Source:HGNC Symbol;Acc:921]
Mouse Orthologue:
B3gat1
Mouse Description:
beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) Gene [Source:MGI Symbol;Acc:MGI:1924148

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9006 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9006
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059344 Nonsense 276 334 3 5
Genomic Location (Zv9):
Chromosome 18 (position 34454272)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36133428
GRCz11 18 36114436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCATCAACCTGAGGCTTATTCTKWTTAAGCCTCAGGCCTATTTCAAGTTA[C/T]GAGGGGTTAAGGGAGGCTACCAGGAGAGCAGCCTGCTCAGAGAGCTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link