wu:fb11f01

Ensembl ID:
ENSDARG00000040534
ZFIN IDs:
ZDB-GENE-030131-8424, ZDB-GENE-040426-2209, ZDB-GENE-050417-57
Description:
epithelial cell adhesion molecule [Source:RefSeq peptide;Acc:NP_001017593]
Human Orthologues:
EPCAM, TACSTD2
Human Descriptions:
epithelial cell adhesion molecule [Source:HGNC Symbol;Acc:11529]
tumor-associated calcium signal transducer 2 [Source:HGNC Symbol;Acc:11530]
Mouse Orthologues:
Epcam, Tacstd2
Mouse Descriptions:
epithelial cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:106653]
tumor-associated calcium signal transducer 2 Gene [Source:MGI Symbol;Acc:MGI:1861606]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22225 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059321 Nonsense 121 303 4 10

The following transcripts of ENSDARG00000040534 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 8207465)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8509985
GRCz11 13 8842008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTGTAACAACACTGAAGTATGCTGGTGCGTCAACAGTGCTGGTGTA[C/T]GAAGAAGTGACAAGAAAGACAAGAACATAAAGTGCGAGCCTGCGGAGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link