zgc:92296

Ensembl ID:
ENSDARG00000040526
ZFIN ID:
ZDB-GENE-041114-188
Description:
sphingosine-1-phosphate receptor 1 [Source:RefSeq peptide;Acc:NP_001007317]
Human Orthologue:
S1PR5
Human Description:
sphingosine-1-phosphate receptor 5 [Source:HGNC Symbol;Acc:14299]
Mouse Orthologue:
S1pr5
Mouse Description:
sphingosine-1-phosphate receptor 5 Gene [Source:MGI Symbol;Acc:MGI:2150641]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059310 Nonsense 327 375 2 2
ENSDART00000132987 Nonsense 351 399 2 2
Genomic Location (Zv9):
Chromosome 3 (position 19187928)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19216290
GRCz11 3 19366030
KASP Assay ID:
554-2589.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTAAGACTGGTCTGCAGCTATTGTCTGCTAACAAAAGATGGACAGGTC[A/T]AGAAGTTTGGCATGCCGTTTCTGGATTGTAGCACCAGTAGGGCAGAAGTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link