Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
yif1b
- Ensembl ID:
- ENSDARG00000040505
- ZFIN ID:
- ZDB-GENE-041114-16
- Description:
- Protein YIF1B [Source:UniProtKB/Swiss-Prot;Acc:Q5U3G6]
- Human Orthologue:
- YIF1B
- Human Description:
- Yip1 interacting factor homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:30511]
- Mouse Orthologue:
- Yif1b
- Mouse Description:
- Yip1 interacting factor homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1924504]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa36734 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa36734
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000059285 | Essential Splice Site | 125 | 304 | 4 | 8 |
| ENSDART00000132751 | Essential Splice Site | 122 | 255 | 4 | 8 |
| ENSDART00000142004 | Essential Splice Site | 125 | 174 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 18 (position 48105906)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 49259667 GRCz11 18 49254444 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTAAAGAGATAATCGTGTTTTAACTTCTGAATGTTTGTTTATGGTGCA[G/A]AACTGGGAGGTGAACTATCAGCAGGACACACCAGTCGCTCCACGCTTCGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
