yif1b

Ensembl ID:
ENSDARG00000040505
ZFIN ID:
ZDB-GENE-041114-16
Description:
Protein YIF1B [Source:UniProtKB/Swiss-Prot;Acc:Q5U3G6]
Human Orthologue:
YIF1B
Human Description:
Yip1 interacting factor homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:30511]
Mouse Orthologue:
Yif1b
Mouse Description:
Yip1 interacting factor homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1924504]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36734 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059285 Essential Splice Site 125 304 4 8
ENSDART00000132751 Essential Splice Site 122 255 4 8
ENSDART00000142004 Essential Splice Site 125 174 4 6
Genomic Location (Zv9):
Chromosome 18 (position 48105906)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 49259667
GRCz11 18 49254444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAAAGAGATAATCGTGTTTTAACTTCTGAATGTTTGTTTATGGTGCA[G/A]AACTGGGAGGTGAACTATCAGCAGGACACACCAGTCGCTCCACGCTTCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link