snx10b

Ensembl ID:
ENSDARG00000040474
ZFIN ID:
ZDB-GENE-070628-1
Description:
sorting nexin 10b [Source:RefSeq peptide;Acc:NP_001103866]
Human Orthologue:
SNX10
Human Description:
sorting nexin 10 [Source:HGNC Symbol;Acc:14974]
Mouse Orthologue:
Snx10
Mouse Description:
sorting nexin 10 Gene [Source:MGI Symbol;Acc:MGI:1919232]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22815 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22815
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059239 Nonsense 53 170 2 4
Genomic Location (Zv9):
Chromosome 16 (position 23122129)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21231880
GRCz11 16 21037699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCACTAAGAAGAGCTCCTGTGTGCGGCGGAGATTCAGCGAGTTTGTGTG[G/A]TTAAGAAAAAAGCTACAGGAAAATGCCTTGCTCATGTATGTAGCCGTTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link