vil1l

Ensembl ID:
ENSDARG00000040466
ZFIN ID:
ZDB-GENE-040426-799
Description:
villin-1 [Source:RefSeq peptide;Acc:NP_956532]
Human Orthologue:
VIL1
Human Description:
villin 1 [Source:HGNC Symbol;Acc:12690]
Mouse Orthologue:
Vil1
Mouse Description:
villin 1 Gene [Source:MGI Symbol;Acc:MGI:98930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41546 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059228 Nonsense 603 834 15 20
ENSDART00000135156   None 239 None 7

The following transcripts of ENSDARG00000040466 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 45986728)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 45118393
GRCz11 9 44919345
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATAGCTGAAGGCCAGGAACCAGCTGACTTCTGGGTTAATCTAGGTGGA[A/T]AGTCCCAGTATGCTAGCAACAAAAGGTACTGTACAGTAACATTTGCACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link