wdfy2

Ensembl ID:
ENSDARG00000040453
ZFIN ID:
ZDB-GENE-041111-211
Description:
WD repeat and FYVE domain-containing protein 2 [Source:RefSeq peptide;Acc:NP_991308]
Human Orthologue:
WDFY2
Human Description:
WD repeat and FYVE domain containing 2 [Source:HGNC Symbol;Acc:20482]
Mouse Orthologue:
Wdfy2
Mouse Description:
WD repeat and FYVE domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2442811]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7183 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa7183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059209 Nonsense 10 400 1 12

The following transcripts of ENSDARG00000040453 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 24857281)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24013067
GRCz11 9 23823936
KASP Assay ID:
554-4971.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTCGGACAAACTACGGCGCCATGGCGGCAGAGATTCATCCCCGCCCG[C/T]AGACACGCAAGCCCGTCCTGCTGAGCAAGATCGAGGGTTTYCAAGATGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link