si:dkey-266j9.3

Ensembl ID:
ENSDARG00000040452
ZFIN ID:
ZDB-GENE-050419-204
Description:
Uncharacterized protein KIAA1370 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1LV22]
Human Orthologue:
KIAA1370
Human Description:
KIAA1370 [Source:HGNC Symbol;Acc:25609]
Mouse Orthologue:
BC031353
Mouse Description:
cDNA sequence BC031353 Gene [Source:MGI Symbol;Acc:MGI:2387648]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11181 Nonsense Available for shipment Available now
sa15989 Nonsense Available for shipment Available now
sa23352 Nonsense Available for shipment Available now
sa23353 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059208 Nonsense 180 1030 4 12
ENSDART00000129750 Nonsense 180 1021 4 12
Genomic Location (Zv9):
Chromosome 18 (position 37270721)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 38852424
GRCz11 18 38833432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTGTTGCAGGAGTGGAGATCGATTCATAGAAGAGAAGACCTTGCTGT[T/A]GGCRGTGCGCTCCTAKGTGTTTTTCTCCCAGCTCAGTGCGTGGCTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15989
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059208 Nonsense 645 1030 5 12
ENSDART00000129750 Nonsense 645 1021 5 12
Genomic Location (Zv9):
Chromosome 18 (position 37272348)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 38854051
GRCz11 18 38835059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCRTCACAAAATCACAGCCTTTAACWGCAAGTAATCACCAACACTA[T/A]GTCAGYAGAGAGTCCTGKACCTCCTTGAAAAACAACTCTAGCCATGCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059208 Nonsense 681 1030 5 12
ENSDART00000129750 Nonsense 681 1021 5 12
Genomic Location (Zv9):
Chromosome 18 (position 37272454)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 38854157
GRCz11 18 38835165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGGAGAATGGACTGACCCAAATTGGATACCATCAGCCCTTCAAGAAC[C/T]GAGTGGCAATCAGTGAAAAAGAAGCAGAAAAACACGTCCGGGACGGGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059208 Essential Splice Site 914 1030 10 12
ENSDART00000129750 Essential Splice Site 905 1021 10 12
Genomic Location (Zv9):
Chromosome 18 (position 37282904)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 38864607
GRCz11 18 38845615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCGGTAAAAGGGGATATCGAGTACCTCCTTCAGGAACCATTCAAGTG[G/A]TAAGATTCATCAAATTATTTTAAAAACCTACTGAATGTTCTGCTTACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link