zgc:55856

Ensembl ID:
ENSDARG00000040433
ZFIN ID:
ZDB-GENE-040426-822
Description:
hypothetical protein LOC393204 [Source:RefSeq peptide;Acc:NP_956529]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19948 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19948
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015232 Nonsense 154 503 3 9
ENSDART00000134497 Nonsense 127 234 4 6

The following transcripts of ENSDARG00000040433 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 8826746)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8364213
GRCz11 3 8241955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCGCTGTCAAACCTACGAGACTTTGGAATGGGCAAAAAGAGAAGTGAA[G/T]AACTGATCACTGAAGAGATCAAATATCTAAAGGAGGAAATTGAGAGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link