klf2b

Ensembl ID:
ENSDARG00000040432
ZFIN ID:
ZDB-GENE-011109-2
Description:
Kruppel-like factor 2b [Source:RefSeq peptide;Acc:NP_571932]
Human Orthologue:
KLF2
Human Description:
Kruppel-like factor 2 (lung) [Source:HGNC Symbol;Acc:6347]
Mouse Orthologue:
Klf2
Mouse Description:
Kruppel-like factor 2 (lung) Gene [Source:MGI Symbol;Acc:MGI:1342772]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43252 Nonsense Mutation detected in F1 DNA During 2018
sa45666 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059188 Nonsense 11 363 1 4
Genomic Location (Zv9):
Chromosome 19 (position 17847772)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17832802
GRCz11 2 55665354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACCGAGCACGCGTGGACATGGCTTTACCTTGCCTTTTGCCTTCGATTT[C/A]AACGTTTGCAAACCAGAAGGAGAAGCTCTGGGAGGATGTAAGTATTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059188 Essential Splice Site None 363 3 4
Genomic Location (Zv9):
Chromosome 19 (position 17852448)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17837478
GRCz11 2 55670030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCTGGTGTTAAAATCTAGCCTAGAGCACACTGTGGTGTTAAAAACTAG[C/A]CTAGAGCGCCTTCTGCTGCTCAAAACTAGCCTAGATTTCTGTTAAAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link