zgc:194733

Ensembl ID:
ENSDARG00000040431
ZFIN ID:
ZDB-GENE-080721-19
Description:
hypothetical protein LOC100170784 [Source:RefSeq peptide;Acc:NP_001124095]
Human Orthologue:
CYP2W1
Human Description:
cytochrome P450, family 2, subfamily W, polypeptide 1 [Source:HGNC Symbol;Acc:20243]
Mouse Orthologue:
Cyp2w1
Mouse Description:
cytochrome P450, family 2, subfamily w, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3616076]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45134 Essential Splice Site Mutation detected in F1 DNA During 2018
sa12197 Nonsense Available for shipment Available now
sa33102 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40007 Nonsense Mutation detected in F1 DNA During 2018
sa13788 Essential Splice Site Available for shipment Available now
sa14880 Essential Splice Site Available for shipment Available now
sa19954 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45134
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Essential Splice Site 66 507 1 9
Genomic Location (Zv9):
Chromosome 3 (position 12482332)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12633317
GRCz11 3 12784766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAACTTGCACACATTGGACCTAAAAAACCTGCACGTGAGCCTTTGGGAA[G/A]TGAGTTAAATATAGTTTATTTCCTTGCCTTGTTTTAAAAAGTTAGTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Nonsense 120 507 2 9
Genomic Location (Zv9):
Chromosome 3 (position 12480117)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12635532
GRCz11 3 12786981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTGGAGAAAGGGACATTACACMGATATTCCAGGACTGTAATCAGGGA[C/T]AAGGTAAAACAKCAACTATAAGATTAATATGAYACTGCAYGTTTGTGGST
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Essential Splice Site 170 507 3 9
Genomic Location (Zv9):
Chromosome 3 (position 12477953)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12637696
GRCz11 3 12789145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCGTGGATGAAACACGTTATCTGCGGGAAGTGTTTATGAAGTTTGAAG[G/T]TACCGTAGAGCGATCGCCGATGCGAATGCTTTTCTTTTCTACATATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Nonsense 229 507 5 9
Genomic Location (Zv9):
Chromosome 3 (position 12474495)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12641154
GRCz11 3 12792603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCCTTTTAAAGCTGTTTGTGTCTCTTCTTGCAGATCTACAACATGTG[T/A]CCATTTTTGGGTCCCTGGATTAAGACCTGGAGACAGCTAATGAAAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Essential Splice Site 331 507 6 9
Genomic Location (Zv9):
Chromosome 3 (position 12471952)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12643697
GRCz11 3 12795146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGCTGCGCTGGGGTCTGATGCTCATGGCCAAATACCCTCAAATACAAG[G/A]TCAGACGTACAAACTGAGGAGAAAAKATGCTGTTTTCNCTAGTRCCTTCMC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Essential Splice Site 441 507 9 9
Genomic Location (Zv9):
Chromosome 3 (position 12465244)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12650405
GRCz11 3 12801854
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTSKGGTGTCTTAAAATAGYCATTCCTTACATGATTTGTTTTTCTMTC[A/C]GGGCGCAGGGCTTGTCTTGGARAGRGTTTGGCCAGRAWGGAGCTCTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059182 Nonsense 495 507 9 9
Genomic Location (Zv9):
Chromosome 3 (position 12465081)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 12650568
GRCz11 3 12802017
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGATCTCACACCGGTGGTGGGCCTGACTTTGAACCCTTCACCCCAC[A/T]AACTGTGTGCAGTCATCAGAGCGGAAAGACAACTAAACTGATCCCTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link