zgc:123296

Ensembl ID:
ENSDARG00000040387
ZFIN ID:
ZDB-GENE-051120-39
Description:
monocyte to macrophage differentiation protein [Source:RefSeq peptide;Acc:NP_001032496]
Human Orthologue:
MMD
Human Description:
monocyte to macrophage differentiation-associated [Source:HGNC Symbol;Acc:7153]
Mouse Orthologue:
Mmd
Mouse Description:
monocyte to macrophage differentiation-associated Gene [Source:MGI Symbol;Acc:MGI:1914718]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6879 Nonsense Mutation detected in F1 DNA During 2018
sa40005 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059117 Nonsense 133 239 5 7
Genomic Location (Zv9):
Chromosome 3 (position 11816309)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11598007
GRCz11 3 11564550
KASP Assay ID:
554-4861.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCTCCGGGAACTCGGGCCRCTYGCCGCTCACATGCGCTGGTTTGTGTG[G/A]TTGATGGCGGCTGCCGGAACAATCTATGTGTTTAATTACCAYGAAAAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40005
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059117 Essential Splice Site 149 239 5 7
Genomic Location (Zv9):
Chromosome 3 (position 11816358)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 11598056
GRCz11 3 11564599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTTGATGGCGGCTGCCGGAACAATCTATGTGTTTAATTACCACGAAAAG[T/G]ATGTTGGACATCACCTAAATATCTAATTCAGACATCATATTTTAATTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link