zgc:113334

Ensembl ID:
ENSDARG00000040374
ZFIN ID:
ZDB-GENE-050306-22
Description:
Transmembrane protein 182 [Source:UniProtKB/Swiss-Prot;Acc:Q5CZV0]
Human Orthologue:
TMEM182
Human Description:
transmembrane protein 182 [Source:HGNC Symbol;Acc:26391]
Mouse Orthologue:
Tmem182
Mouse Description:
transmembrane protein 182 Gene [Source:MGI Symbol;Acc:MGI:1923725]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34551 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41351 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa34551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059092 Essential Splice Site 48 248 1 5
Genomic Location (Zv9):
Chromosome 9 (position 6968701)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6948794
GRCz11 9 6927185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCATCTGAGACCTGCAATTCATATTCAAATAGTCCAGTTACTTCTGAG[G/A]TGGGTGTGTTGCTTCAAGTGTTTTAATATGGGGGGTAATATGAAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059092 Essential Splice Site 95 248 2 5
Genomic Location (Zv9):
Chromosome 9 (position 6963343)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6943436
GRCz11 9 6921827
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTTCGATGACGTCATGAACGATGGCAATCTGTGGAAGTTCTGGTTTGG[T/C]AAGAGATTGTGTTTTAGCTTTTGAGCAATATACATTCGGAGATGTCTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link