zgc:194152

Ensembl ID:
ENSDARG00000040303
ZFIN ID:
ZDB-GENE-041008-35
Description:
Nibrin [Source:UniProtKB/Swiss-Prot;Acc:Q5I2W8]
Human Orthologue:
NBN
Human Description:
nibrin [Source:HGNC Symbol;Acc:7652]
Mouse Orthologue:
Nbn
Mouse Description:
nibrin Gene [Source:MGI Symbol;Acc:MGI:1351625]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22834 Nonsense Available for shipment Available now
sa28655 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058974 Nonsense 202 818 6 16
ENSDART00000131238 Nonsense 202 857 6 16
Genomic Location (Zv9):
Chromosome 16 (position 26089158)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23934833
GRCz11 16 23849865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAAATTGATGAGCCCAGCCTGGCTAGAGATGATGTGGATCTGAGTGCA[C/T]GACCTGAGAGAAAGAGCCTCTTCAAGGGGAAAACATTCCTGTTTTTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058974 Essential Splice Site 754 818 13 16
ENSDART00000131238 Essential Splice Site 754 857 13 16
Genomic Location (Zv9):
Chromosome 16 (position 26108605)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23954280
GRCz11 16 23869312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTACAGACACACAATCCAAATGACAAGAACGTCAAAAGATTTCGCAAG[G/T]TATGACAAAACGTCTCATTATCACACATCTGTAATATTGTGACCAAGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link