si:dkey-7f3.6

Ensembl ID:
ENSDARG00000040302
ZFIN ID:
ZDB-GENE-081028-57
Human Orthologue:
OSGIN2
Human Description:
oxidative stress induced growth inhibitor family member 2 [Source:HGNC Symbol;Acc:1355]
Mouse Orthologue:
Osgin2
Mouse Description:
oxidative stress induced growth inhibitor family member 2 Gene [Source:MGI Symbol;Acc:MGI:2384798]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18604 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058973 Nonsense 38 523 2 7
ENSDART00000132243 Nonsense 38 549 3 6
Genomic Location (Zv9):
Chromosome 16 (position 26121503)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23967178
GRCz11 16 23882210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGTAATGGTCCTTCTGGTATATGCCTGTCATACCTGCTTAATGGATA[T/G]ACTCCTTATTTGGATCCCAAGGCTGTGCACCCAAACCACATCCTCTTTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link