
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
runx2a
- Ensembl ID:
- ENSDARG00000040261
- ZFIN ID:
- ZDB-GENE-040629-3
- Description:
- runt-related transcription factor 2 [Source:RefSeq peptide;Acc:NP_998023]
- Human Orthologue:
- RUNX2
- Human Description:
- runt-related transcription factor 2 [Source:HGNC Symbol;Acc:10472]
- Mouse Orthologue:
- Runx2
- Mouse Description:
- runt related transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:99829]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa13625 | Nonsense | Available for shipment | Available now |
sa2928 | Essential Splice Site | F2 line generated | During 2018 |
Mutation Details
- Allele Name:
- sa13625
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081849 | None | 203 | None | 5 | |
ENSDART00000081854 | None | 57 | None | 4 | |
ENSDART00000105394 | Nonsense | 192 | 467 | 5 | 7 |
ENSDART00000131430 | Nonsense | 178 | 453 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 5222718)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 5323372 GRCz11 17 5480468 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CAGGAGGGGTGTTAAYTGCAATCTCTGTCTAATATTRTTCGTTAGGACAC[A/T]GACAGAAACTGGAAGACCCCCCTAAACCGCCGCTGTTCTCCGAGCGCCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa2928
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000081849 | None | 203 | None | 5 | |
ENSDART00000081854 | None | 57 | None | 4 | |
ENSDART00000105394 | Essential Splice Site | 303 | 467 | 6 | 7 |
ENSDART00000131430 | Essential Splice Site | 289 | 453 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 17 (position 5227964)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 17 5328618 GRCz11 17 5485714 - KASP Assay ID:
- 554-3337.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CGTGCCACCGGCCTGCCCACCATCAGCGACGTGCCACGACGCCTCTCAGG[T/C]ACTCACACCTGCAGAAACCACACAAATTAGGGTACGCTCACACTACRCTA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Many sequence variants affecting diversity of adult human height. (View Study)
- Periodontal microbiota: Genome-wide association study of periodontal pathogen colonization. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: