zgc:165461

Ensembl ID:
ENSDARG00000040162
ZFIN ID:
ZDB-GENE-050208-135
Description:
hypothetical protein LOC497419 [Source:RefSeq peptide;Acc:NP_001093609]
Human Orthologue:
FGFBP2
Human Description:
fibroblast growth factor binding protein 2 [Source:HGNC Symbol;Acc:29451]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058745 Nonsense 23 232 1 1
Genomic Location (Zv9):
Chromosome 17 (position 23130819)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23280968
GRCz11 17 23300992
KASP Assay ID:
2261-1001.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCTTTCTCCTTTCCCTTCTCTTCCTCCTCCATTCATTCTCTGAGGCT[A/T]AAAAGAAGCCCAGGCAGCCTTCAGAAGCAGTGGCCGGATCAGACATCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link