zgc:92287

Ensembl ID:
ENSDARG00000040161
ZFIN ID:
ZDB-GENE-040718-350
Description:
hypothetical protein LOC436879 [Source:RefSeq peptide;Acc:NP_001002606]
Human Orthologue:
TMPO
Human Description:
thymopoietin [Source:HGNC Symbol;Acc:11875]
Mouse Orthologue:
Tmpo
Mouse Description:
thymopoietin Gene [Source:MGI Symbol;Acc:MGI:106920]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24288 Essential Splice Site Available for shipment Available now
sa37661 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058742 Essential Splice Site 99 285 2 6
Genomic Location (Zv9):
Chromosome 23 (position 18218840)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18121779
GRCz11 23 18048122
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCAAAGCCAAACTGCTTCAATATGGTGTTAAAGCTGGACCCATTCTAG[G/A]TCAGTCTGTTGAAGTCACGGTTGTTTGGCTTTTAAAACAGTTTATGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37661
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058742 Nonsense 230 285 6 6
Genomic Location (Zv9):
Chromosome 23 (position 18203908)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18106847
GRCz11 23 18033190
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAATTGCCTCTACTGAGTCCCACTATATTGGAGAGGCAGGAGATTCAG[C/T]AGCGTCTGGTGCCTCTATGGGTTCAGGTCATTGTCTTCCTTATGGTGGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link