
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
glt8d1
- Ensembl ID:
- ENSDARG00000040157
- ZFIN ID:
- ZDB-GENE-041114-23
- Description:
- Glycosyltransferase 8 domain-containing protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q5U3H3]
- Human Orthologue:
- GLT8D1
- Human Description:
- glycosyltransferase 8 domain containing 1 [Source:HGNC Symbol;Acc:24870]
- Mouse Orthologue:
- Glt8d1
- Mouse Description:
- glycosyltransferase 8 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1923735]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15034 | Essential Splice Site | Available for shipment | Available now |
sa21836 | Nonsense | Available for shipment | Available now |
sa41767 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15034
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058735 | Essential Splice Site | 145 | 365 | 5 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 4039848)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 3958352 GRCz11 11 3977739 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTTGGGWAAGATTCCTACTGATGCTCAGAAGATKGAGACMGTGARGCCGG[T/G]AAACATATATGCATTTRTTTCAATWGWATTRTATGRTGTGGAGCAAAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21836
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058735 | Nonsense | 229 | 365 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 4037344)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 3955848 GRCz11 11 3975235 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGCTACATTGGTTATCTGGACTTTAAGAAGGAAGCGATTAAGAAGCTT[G/T]GAATGAGAGCAAACACTTGCTCCTTCAATCCTGGAGTCTTCGTGGCCAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41767
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058735 | Nonsense | 261 | 365 | 8 | 10 |
- Genomic Location (Zv9):
- Chromosome 11 (position 4037246)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 3955750 GRCz11 11 3975137 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATTTAACCGAGTGGAAGCAGCAGAACGTCACCAGTCAGCTTGAGTTCTG[G/A]ATGGAGCGCAATGCTAAGTTAGTTTTGTGTTCAGTTACTTGTGTTTGGCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
- Osteoarthritis: Identification of new susceptibility loci for osteoarthritis (arcOGEN): a genome-wide association study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: