zfpm2a

Ensembl ID:
ENSDARG00000040123
ZFIN ID:
ZDB-GENE-060130-4
Description:
zinc finger protein ZFPM2 [Source:RefSeq peptide;Acc:NP_001034724]
Human Orthologue:
ZFPM2
Human Description:
zinc finger protein, multitype 2 [Source:HGNC Symbol;Acc:16700]
Mouse Orthologue:
Zfpm2
Mouse Description:
zinc finger protein, multitype 2 Gene [Source:MGI Symbol;Acc:MGI:1334444]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36240 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42806 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058685 Essential Splice Site 140 1142 None 8
ENSDART00000102414 Essential Splice Site 139 194 None 6
ENSDART00000104583 Essential Splice Site 140 195 None 5
ENSDART00000141941 Essential Splice Site 41 1042 None 5
Genomic Location (Zv9):
Chromosome 16 (position 46823920)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44023690
GRCz11 16 43971138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACATGGGGGCCTTTCGAGGGCAAAATTGAGCTGAACACAGACGCACAGG[T/C]ACAGTCCATCTCGTTTAAATGTTGATGAGGGTTAAAGGCCAAACATGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058685 Nonsense 1069 1142 8 8
ENSDART00000102414   None 194 None 6
ENSDART00000104583   None 195 None 5
ENSDART00000141941 Nonsense 969 1042 5 5
Genomic Location (Zv9):
Chromosome 16 (position 46672917)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 43872687
GRCz11 16 43820135
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCAGCCTCACAATACCTCATTGCCAGAGGAACAAACATCTCCCACATG[G/A]GGAGCCGAGAACCCTCCCGACCCAAACGAGAATGTATCACCAACTTCTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link