si:dkey-95h12.1

Ensembl ID:
ENSDARG00000040100
ZFIN ID:
ZDB-GENE-060503-85
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5PN31]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45630 Nonsense Mutation detected in F1 DNA During 2018
sa23236 Nonsense Available for shipment Available now
sa31021 Nonsense Mutation detected in F1 DNA During 2018
sa5908 Nonsense Mutation detected in F1 DNA During 2018
sa43049 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45630
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058647 Nonsense 23 754 1 6
ENSDART00000143619 Nonsense 23 498 1 2
Genomic Location (Zv9):
Chromosome 18 (position 8350273)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8927651
GRCz11 18 8885670
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTGGCAGCTCTTGGAAGACCTCTGTTTCCTGGAATGCTGTATGATTG[C/A]CGCAAAGATTCCTTCATTCCAGGTGGTGTGCCTAGTCTTATGAAAAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058647 Nonsense 221 754 2 6
ENSDART00000143619 Nonsense 221 498 2 2
Genomic Location (Zv9):
Chromosome 18 (position 8349520)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8926898
GRCz11 18 8884917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACATTTTACGGTGACTTTCATCTTGAGCAAAGTCCAACTTCTTACATC[G/T]AGGCCCTTGATTTGTACAAGAAGCTCCCCTCTTTGCTGAATAATTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058647 Nonsense 378 754 2 6
ENSDART00000143619 Nonsense 378 498 2 2
Genomic Location (Zv9):
Chromosome 18 (position 8349048)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8926426
GRCz11 18 8884445
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAATTTAACCTCTTGAGTTCTTACATTAAGGGGATCAAGATTGAAGATT[C/A]AGACAATCTCAACACTGTCCTCTTTGATCCTAATGTTGACTTTGTGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058647 Nonsense 527 754 2 6
ENSDART00000143619   None 498 None 2
Genomic Location (Zv9):
Chromosome 18 (position 8348602)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8925980
GRCz11 18 8883999
KASP Assay ID:
554-3775.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTCCATGAACAAACCRTGTCCCTGAAACTGCAGAAGTCCCCAACTGGA[G/T]AAACAGAGCAGTACAGAGTGGAGTACAAGCAGGTAAAAGAAGAATCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058647 Nonsense 735 754 6 6
ENSDART00000143619   None 498 None 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 8337785)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 8915163
GRCz11 18 8873182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCACACCTTATGAATTTCAAGCATCGGATCCAAGAGCTCGACCAGATC[A/T]GAGGCATTGGCATCTACCGTGATGTGACCCTCAGCTCTTTAAATGTGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link