zgc:66432

Ensembl ID:
ENSDARG00000040081
ZFIN ID:
ZDB-GENE-030131-5827
Description:
hypothetical protein LOC327616 [Source:RefSeq peptide;Acc:NP_956132]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42796 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42795 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058620 Essential Splice Site 179 599 1 9
Genomic Location (Zv9):
Chromosome 16 (position 44835445)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42115953
GRCz11 16 42065985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTTTTATTTCCATTATGACCTCAATGACTGTGATAGCTCGTTAATGG[T/G]AAGTACTGAACGTTAACCTCATAAAGTCAAGGACACTGTAAAAAAAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42795
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058620 Essential Splice Site 400 599 8 9
Genomic Location (Zv9):
Chromosome 16 (position 44828407)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42108915
GRCz11 16 42058947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGACTGTCTGTGTGTAAACTGAAAACATTACATCTTTTGCTTCTACAAC[A/T]GCTTATTTTCCCAGTATGACACAATCTCTGATATCAAGCAAACCCTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link