
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fli1b
- Ensembl ID:
- ENSDARG00000040080
- ZFIN ID:
- ZDB-GENE-031114-3
- Description:
- friend leukemia integration 1b [Source:RefSeq peptide;Acc:NP_001008780]
- Human Orthologue:
- FLI1
- Human Description:
- Friend leukemia virus integration 1 [Source:HGNC Symbol;Acc:3749]
- Mouse Orthologue:
- Fli1
- Mouse Description:
- Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa36230 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa36230
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000058613 | Nonsense | 186 | 467 | 4 | 9 |
ENSDART00000102789 | Nonsense | 176 | 458 | 4 | 9 |
ENSDART00000121474 | Nonsense | 176 | 458 | 5 | 10 |
ENSDART00000124717 | Nonsense | 176 | 485 | 4 | 10 |
ENSDART00000134010 | Nonsense | 176 | 457 | 4 | 9 |
- Genomic Location (Zv9):
- Chromosome 16 (position 44809417)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 16 42089925 GRCz11 16 42039957 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCCCTCTTCCAGACCCTGGATGGAAAAGCGCTCTGCAAATTGAGCAAA[G/T]AGGACATGATGCGCATCACCTCCGCATACAACACAGACATCCTGCTCTCC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
- Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
- Rheumatoid arthritis: Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: