snai2

Ensembl ID:
ENSDARG00000040046
ZFIN ID:
ZDB-GENE-030326-6
Description:
zinc finger protein SNAI2 [Source:RefSeq peptide;Acc:NP_001008581]
Human Orthologue:
SNAI2
Human Description:
snail homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:11094]
Mouse Orthologue:
Snai2
Mouse Description:
snail homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1096393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24539 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24539
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058571 Nonsense 126 257 2 3
ENSDART00000125935 Nonsense 126 257 2 4
Genomic Location (Zv9):
Chromosome 24 (position 36885806)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35504168
GRCz11 24 35390665
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTGTCGGACGCTGAGAAGTTTCAGTGCGGTTTGTGTAACAAGTCCTA[C/A]AGCACGTATTCGGGACTCATGAAGCACAAACAGCTGCACTGCGACGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link