tardbp

Ensembl ID:
ENSDARG00000040031
ZFIN ID:
ZDB-GENE-030131-3777
Description:
TAR DNA-binding protein 43 [Source:RefSeq peptide;Acc:NP_958884]
Human Orthologue:
TARDBP
Human Description:
TAR DNA binding protein [Source:HGNC Symbol;Acc:11571]
Mouse Orthologue:
Tardbp
Mouse Description:
TAR DNA binding protein Gene [Source:MGI Symbol;Acc:MGI:2387629]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40779 Nonsense Mutation detected in F1 DNA During 2018
sa40778 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa40779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058555 Nonsense 7 412 2 6
Genomic Location (Zv9):
Chromosome 6 (position 45883532)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45944466
GRCz11 6 45946348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCATTCACCGTCAGCTCGACTGAGGAAAGATGGCCGAGATGTACATT[C/T]GAGTTGCGGAGGAGGAGAATGAGGAGCCGATGGAGATCCCGTCAGAGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40778
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058555 Nonsense 360 412 6 6
Genomic Location (Zv9):
Chromosome 6 (position 45876406)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 45937340
GRCz11 6 45939222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATCAGTCGGGTACTTCAGGCACAAGCACAAGTGGCACCAGTTCCTCT[C/T]GAGACCAAGCCCAAACATATAGCTCGGCTAACAGCAATTACGGCAGCAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ewing sarcoma: Common variants near TARDBP and EGR2 are associated with susceptibility to Ewing sarcoma. (View Study)
  • Male-pattern baldness: Six novel susceptibility Loci for early-onset androgenetic alopecia and their unexpected association with common diseases. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link