si:dkey-90m5.1

Ensembl ID:
ENSDARG00000040009
ZFIN ID:
ZDB-GENE-041014-252
Description:
Novel protein similar to vertebrate palladin [Source:UniProtKB/TrEMBL;Acc:Q5RHD8]
Human Orthologue:
MYPN
Human Description:
myopalladin [Source:HGNC Symbol;Acc:23246]
Mouse Orthologue:
Mypn
Mouse Description:
myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43431 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43431
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058532 Essential Splice Site 627 707 9 11
ENSDART00000147945   None 285 None 3
Genomic Location (Zv9):
Chromosome 20 (position 23570379)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 23683766
GRCz11 20 23582866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCAGCAGTTAGGGCTCCACCTCTTCCCACCAAACCCAAACCTAAACTG[T/C]GAGTACTGCAGCTGAATCTTGTAAATCATCAAATCTTTTTGTTTATAAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link